Ethics Statement

Practitioners obtained oral non-opposition from duly informed patients to perform clinical data analysis.

From 2005 to 2013, treatment advice from a French National Reference Center for Leishmaniasis (FNRCL) expert was sought for 25 VL patients (Fig 1A). All received L-AmB as first-line treatment [2]; 4 became unresponsive (i.e., failure or relapse with positive Leishmania PCR after ≥2 complete courses (20–60 mg/kg cumulated dose/course, Fig 1B). Cure was defined as a negative smear, culture or PCR on leukoconcentrated blood plus remission of VL signs and symptoms with no relapse during 6 months. Relapse was defined as a positive Leishmania PCR in any sample associated with recurrence of ≥3 of the following markers: fever, splenomegaly, hepatomegaly, anemia, leukopenia, thrombocytopenia, weight loss, asthenia, digestive or cutaneous symptoms suggestive of VL. Previous explorations had shown that patients who respond to L-AmB have a several-Log decline in parasitemia (as assessed by quantitative PCR) in less than 3 weeks [10]. We used a kinetoplastic DNA target [11] using the following primers and probe: 15 pmol of direct primer (CTTTTCTGGTCCTCCGGGTAGG), 15 pmol of reverse primer (CCACCCGGCCCTATTTTACACCAA), and 50 pmol of TaqMan probe (FAM-TTTTCGCAGAACGCCCCTACCCGC-TAMRA).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. “black rectangle” VL episode; “hatched rectangle” oligosymptomatic VL; BM: bone marrow; PB: peripheral blood; LN: lymph node; BAL: broncho-alveolar lavage; q.3.w: every 3 weeks; mo: month; quantitative PCR (N = negative; 1+ = 0.5–10; 2+ = 11–100; 3+ = 101–1000; 4+ = 1001–100000; 5+ >100000 parasites/ml).

(A)Treatment advice for VL: All patients received L-AmB as first-line treatment[2]; 4 became unresponsive to L-AmB as defined by failure or relapse with positive PCR for Leishmania after at least 2 complete courses (20–60 mg/kg cumulated dose/course). (B) Follow-up of 4 patients non-responders to L-AmB: Cure was defined as a negative smear, culture or PCR on leukoconcentrated blood plus remission of clinical signs and symptoms of VL with no relapse during 6 months. Relapse was defined as positive Leishmania PCR (any sample) associated with recurrence of ≥3 of the following markers: fever, splenomegaly, hepatomegaly, anemia, leukopenia, thrombocytopenia, weight loss, asthenia, digestive or cutaneous symptoms suggestive of VL. Patient information and consent were as per FNRCL procedures (http://www.parasitologie.univ-montp1.fr/conseil.htm). Doses of meglumine antimoniate (Glucantime) are expressed in mg of pentavalent antimony/kg.

https://doi.org/10.1371/journal.pntd.0004304.g001

Patient 1

A 58-year-old male had a history of end-stage renal failure with 3 kidney transplantations (1979, 1981 and 2008). He had previous chronic hepatitis B, legionellosis, chronic Q fever and cytomegalovirus infection. The last renal transplantation was associated with acute rejection requiring a combination of anti-thymoglobulin, plasma exchanges, rituximab, mycophenolate mofetil 1g/d, tacrolimus 4.5mg/d and prednisone 10 mg/d. In 2004 Leishmania PCR in blood was positive (Fig 1B). L-AmB treatment initially induced clinical cure. Relapse occurred in August 2009 when plasma exchanges and corticosteroids boluses were administered for the graft rejection. Fever, anemia (Hb = 9.1g/dL) and leukopenia (leukocytes = 1600/mm³) were observed, along with 431 Leishmania per ml of blood (assessed by quantitative PCR). L-AmB (induction total dose, 40 mg/Kg) provided improvement and reduced parasitemia to 6.9 Leishmania/ml. A second recurrence with fever and a rise in parasitemia to 29.6 Leishmania/ml occurred in January 2010 during monthly maintenance administration of 3 mg/kg of L-AmB. High-dose L-AmB was reintroduced followed by miltefosine for 4 months. Parasitemia decreased but remained positive (0.4 Leishmania/ml) and number of CD4 lymphocytes increased from 87 to 147/mm3. A third recurrence was reported in July 2010 with fever, 29.8 Leishmania/ml and positive Leishmania culture from venous blood. L-AmB was reintroduced, followed by maintenance infusions for 4 months, 3 mg/Kg every 3 weeks plus downgrading of immunosuppressive therapies. As symptoms persisted, infusions were performed once-weekly and then twice-weekly. Parasitemia decreased from 88 to 0.6 Leishmania/ml but a fourth recurrence occurred in April-June 2011 with fever, leukopenia (leukocytes = 1200/mm3, CD4 lymphocytes = 186/mm3), anemia (Hb = 9.1g/dL) and parasitemia at 40 Leishmania/ml. Patient refused to increase the L-AmB dose, it continued at 3 mg/Kg twice-weekly. Transplant nephrectomy was performed in November 2011 and chronic dialysis reinstituted. In February 2012, fever, splenomegaly, anemia (Hb = 8.6g/dL) and thrombocytopenia (platelet count = 50,000/mm3) were observed with 12,870 Leishmania/ml and 60,440 Leishmania/ml of bronchoalveolar lavage fluid. Thereafter, meglumine antimoniate adapted to renal clearance was administered daily for 28 days, then 1–3 times/week for maintenance. Liver function remained normal. ECG showed a T-wave inversion but troponin remained normal. Fever and sweats resolved, spleen size decreased from 21 to 17 cm, and blood counts normalized in 4 weeks, number of CD4 lymphocytes = 833/mm3 in June 2012,. Leishmania blood PCR and cultures became negative within a month and remained negative over eight monthly evaluations until death in January 2013 due to hypovolemic shock following a dental extraction.

Patient 2

A 15-month-old female infant from Georgia arrived in France in September 2010. She had fever, sweats, hepatosplenomegaly, pancytopenia and 213,000 Leishmania/ml. Leishmania amastigotes were observed in the bone marrow. There was no underlying immunosuppression. Treatment with 20 mg/kg of L-AmB resulted in complete resolution of symptoms and parasite clearance from the blood (PCR). Four months later, clinical symptoms recurred with 50 Leishmania/ml. The patient was treated with L-AmB then miltefosine for 28 days, resulting in complete clinical and parasitological response (Fig 1B). Five months later a second overt relapse occurred with typical symptoms and 20 Leishmania/ml. The patient was treated thereafter with meglumine antimoniate with a one-week break for QT interval prolongation. Upon EKG normalization, the course was reinstated with no further QT modifications. All VL clinical signs and laboratory abnormalities resolved. The patient remained relapse-free and PCR-negative 42 months of follow-up.

Patient 3

A 37-year-old male from Georgia came to France in October 2012. He had HIV infection since 2006 inconstantly treated with HAART. Other medical conditions were adrenal insufficiency, cirrhosis due to chronic HCV, and treatment-controlled tuberculosis. VL was diagnosed in 2010 and treated in Georgia with meglumine antimoniate and L-AmB (doses and schedules unknown). In November 2012, he presented hepatosplenomegaly, lymphadenopathies, infiltrated cutaneous lesions, anemia, number of CD4 lymphocytes = 133/mm3, viral load < 50 copies/mL, and parasitemia of 6 Leishmania/ml. He received a course of L-AmB followed by maintenance therapy for 5 months (Fig 1B). In May 2013, he had weight loss, hepatosplenomegaly, anemia, number of CD4 lymphocytes = 177/mm3, viral load < 40 copies/mL and parasitemia of 12 Leishmania/ml. L-AmB treatment was intensified, but renal insufficiency and acute thrombocytopenia occurred. In June, the splenomegaly and parasitemia remained unchanged. A course of meglumine antimoniate was administered. Despite pre-existing liver disorders, the treatment was well tolerated except for mild neutropenia. One month later, a marked clinical improvement was observed and parasitemia decreased to 0.2 Leishmania/ml. In July, maintenance treatment with miltefosine (150 mg/day for 3 months) was started. Parasitemia was negative, the number of CD4 lymphocytes increased from 169 to 540/mm³, and viral load was undetectable. Parasitemia remained negative through 18 months.

Patient 4

A 75-year-old male from Algeria had HIV infection since 2001 treated with nevirapine and lamivudine/zidovudine. He had cerebral toxoplasmosis, chronic hepatitis B, gastrointestinal CMV infection, and anal squamous cell carcinoma. In 2013, the patient started treatment with darunavir, ritonavir, raltegravir and emtricitabine. VL had been diagnosed in 2001, and treated with L-AmB 5 mg/Kg/d for 15 days with partial improvement. Maintenance therapy of 3 mg/kg weekly was planned but irregularly administered. Recurrence was reported in March 2011, the infecting specie was identified as L. infantum. The number of CD4 lymphocytes was 33/mm3, and viral load 75000 copies/mL. The patient received 40 mg/kg of L-AmB, followed by 3 mg/kg at 15-day interval. Clinical improvement was obtained but qualitative PCR remained positive. In 2012, L-AmB infusions were administered at 3-week intervals. In 2013, a last course of 50 mg/kg of L-AmB was administered, Despite this complete course of L-AmB, clinical symptoms worsened (weight loss, fatigue), clinical splenomegaly was present (greater diameter 20 cm on the CT scan), and parasitemia remained positive and stable (from 126 Leishmania/ml before treatment to 118 Leishmania/ml after completion of the course 3 weeks later). Meglumine antimoniate was thus administered, initially at low doses (4–10 mg/kg SbV every other day for 7 weeks) because of advanced age. Treatment was well tolerated except for moderate neutropenia. Fatigue resolved and weight increased from 50 to 61 Kg. The spleen was no longer palpable after 2 months of treatment. Number of CD4 lymphocytes increased from 75 to 134/mm3. Parasitemia cleared and remained negative through 13 months of follow-up.